PCR detection of Schistosoma japonicum cercariae: a potential tool for the field

Despite decades of prevention and control efforts, the water-borne parasitic disease schistosomiasis remains endemic in 74 of the world’s developing nations. Five species of the Schistosoma trematode are pathogenic to humans; S. japonicum is the infective agent of schistosomiasis in China and the Philippines. The purpose of this research is to develop a sensitive and specific technique for the detection of S. japonicum’s larval life-stage (known as cercariae) from water samples. In the field, this will potentially provide a direct measure of the cercarial hazard of irrigation ditch water in villages within China’s Sichuan Province. Endemic for schistosomiasis, these agricultural communities are currently being monitored and assessed for local variations in risk by a study at UC Berkeley’s School of Public Health. To detect free cercariae from water samples, a qualitative polymerase chain reaction (PCR) assay has been developed targeting regions of the retrotransposon SjR2 for amplification. Samples of cercariae obtained from a laboratory population of snail intermediate hosts were assayed following DNA extraction to test the technique. The results demonstrate that the PCR assay is capable of detecting the presence of as little as one cercaria in a water sample, and is not inhibited by additional organic matter contaminants such as those found in local creek water. Further modifications for the field setting will allow this methodology to be tested at the study sites in question. This research was conducted with the assistance of Jennifer Kyle, a graduate student in Dr. Eva Harris’ laboratory in the School of Public Health, Division of Infectious Diseases. Introduction According to the World Health Organization, schistosomiasis is second only to malaria in socio-economic and public health importance in tropical and sub-tropical regions of the world (WHO 1996). An estimated 200 million people in 74 countries are currently infected with the water-borne parasitic disease, with an additional 600 million at risk (WHO 2002). The majority of known cases of schistosomiasis occur in subSaharan Africa and are most often due to intestinal and urinary infection with S. mansoni and S. haematobium, respectively. However, the disease is also endemic to parts of Latin America and the Caribbean, as well South-East Asia and the Western Pacific, where Schistosoma japonicum causes intestinal schistosomiasis. Transmission to humans occurs when people come into contact with bodies of water containing the cercarial (larval) stage of S. japonicum (see figure below). The freeswimming cercarial life stage directly penetrates human skin through a process of mechanical movements and lytic secretions (He, et al 1990). In the human host, the larval forms develop into adult worms that mate, migrate to the host’s mesenteric veins, and produce eggs. The highly antigenic properties of the eggs elicit a myriad of immune responses from the host, such as fibrosis of the liver and spleen, and in severe cases, fatal damage to the lungs and brain. Multiple studies suggest that in certain areas of China schistosomiasis contributes significantly to the population’s morbidity (Li et al. 1993, and Wiest et al. 1992). In China, as well as other regions of East Asia, S. japonicum infection is associated with hepatocellular and colorectal carcinoma (Ishii et al. 1994), childhood malnutrition and growth abnormalities (McGarvey et al. 1993) and gynecological complications such as proximal tubal obstruction (Letterie et al. 1992), rupture of the appendix during pregnancy, and fetal anoxia and subsequent death (Moore and Smith 1989). S. japonicum eggs migrate from the mesenteric veins to the lumen of the intestine and are transported from their mammalian host back to the environment via excreted fecal matter. Once in the water, the eggs hatch and release a free-swimming miracidium that seeks out an appropriate species of snail as an intermediate host. This stage of the life cycle can only be completed if the necessary snail is within close range of the miracidium. In the case of the S. japonicum strain found in China, the required snail species is Oncomelania hupensis. Of concern to control efforts, one study has implicated the completion of the Three Gorges Dam on the Yangtze River in the expansion of the habitat of O. hupensis (Hotez et al. 1997). After a period of maturation in the snails, sporocysts containing hundreds of cercariae develop which are subsequently released from the snail into the water, completing the cycle. Since the 1950s, efforts have been made in the People’s Republic of China to disrupt this life cycle in the interest of preventing schistosomiasis transmission to humans (Minggang and Zheng, 1999). Of particular challenge to disease control is the fact that other animals besides humans can be the definitive host for S.japonicum. In farming communities that have close associations with these animals, risk of transmission is increased by practices such as using cattle dung mixed with human excrement as a fertilizer termed “nightsoil” (Spear et al. 2002). With the financial support of a World Bank Loan to the government of China (1992-1998), morbidity control has been attempted through health education, chemotherapy for humans and cattle, and the reduction of snail populations, including the use of molluscicides. Despite drastic improvements in some regions, the disease remains endemic other areas. Lake and mountainous regions have proven especially challenging, demonstrating that intervention tactics are not without their limitations. For example, chemical molluscicides have successfully controlled some snail populations, but not others (Spear et al. 2002). Praziquantel can be an effective treatment under appropriate social and economic conditions, but already research has indicated an increase in praziquantel resistant strains (Black 2002). In short, no single intervention has proven sufficient to control schistosomiasis transmission across China’s diverse environment. Over the past decade, a study lead by Dr. Robert Spear of the School of Public Health at the UC Berkeley has developed a mathematical model to describe schistosomiasis transmission in the mountainous Sichuan Province of China a “problem area for the control programme” due to extensive snail habitats and socio-economic underdevelopment (Minggang and Zheng, 1999). The model employs several parameters and calibrates them to local conditions using field data with the objective of developing a tool that will better inform the combination of interventions to be applied in a particular setting, in addition to predicting their effectiveness (Spear et al. 2002). Parameters include established biologic values (e.g. the number of cercariae produced per sporocyst, per day), measurable data (including variables such as estimates of the snail population and human exposure to hazardous water) and environmental inputs such as rainfall and water temperature. The input and measurable parameters rely on data from the field, and the integrity of the model as a whole is influenced by the quality of these measurements. Information about host snail distribution and the presence of S. japonicum in spatially distinct snail populations are two key variables necessary to the development of a mathematical model for schistosomiasis transmission. Global positioning system (GPS) technology is currently used to map the density of the Oncomelania snail population measured via field surveys. Because not all snails are infected, cercarial bioassays using mice are also employed to measure the spatial variation in cercarial concentration in water (Spear et al. 2002). While the low spatial resolution of cercarial data is a serious limitation of the mouse bioassay method, the technique is robust when applied to turbid waters found in the field, and avoids the problems associated with the stickiness of S. japonicum cercariae, which typically makes them difficult to sample with traditional water quality apparatus (Spear et al. 2003). Despite these advantages, however, the use of mouse bioassays is an expensive and time-consuming endeavor. The intent of this project is to develop a method in the laboratory for the detection of S. japonicum cercariae from water samples. This method can then be adapted for and applied to field samples with the objective of improving the accuracy of the estimate of cercarial hazard of surface waters in the study described above and, possibly, to eliminate the need for mouse bioassays. Polymerase chain reaction (PCR) is a promising technique for accomplishing this objective. A rapid method of amplifying a specific genetic sequence, PCR exhibits high sensitivity and specificity, limited only by the current genetic information available for the target species. PCR assays have been successfully developed and described for S. mansoni and S. haematobium (Hamburger et al. 2001) and for bird schistosomes (Hertel et al. 2001) and used with pure lab samples as well as water samples taken from the field. Furthermore, PCR does not require high concentrations of the target organism in the sample, as is the case with some immunological detection methods, such as enzymelinked immunosorbent assay (ELISA). PCR assays conducted on S. mansoni have successfully demonstrated a detection level of as few as one cercaria per sample (Hamburger et al. 1998). PCR is also less susceptible to cross-contamination in the field than immunological techniques, although there is a risk of cross-hybridization to species with very similar genomes, depending on the genetic sequence selected for amplification. In the present study, a highly sensitive PCR assay was developed for the successful identification of S. japonicum cercariae in laboratory samples. The primers were designed based on the sequence of a retrotransposon that is present in multiple copies in the S. japonicum genome. Methods Thirteen infected Oncomelania hupensis (subspecies hupensis) snails and seventeen infected Oncomelania hupensis (subspecies chiui) snails were obtained from the laboratory of Dr. Fred Lewis at the National Institutes of Health for the purposes of this study. All were exposed to S. japonicum miracidia in December of 2003 and the majority were determined to be sporocyst-positive prior to their shipment. The snail population was maintained in Petri dishes with a mixture of autoclaved mud, deionized water, and an algal food source for approximately two weeks following their arrival. Over the course of these weeks, the infected snails actively shed cercariae when submerged in water and exposed to a light source. Appropriate measures were taken in accordance with the guidelines of the UC Berkeley Biosafety committee to ensure the safety of everyone in the lab. To perform the PCR assays, samples of individual cercariae were harvested from the snails and their DNA was extracted with the Qiagen DNEasy® commercial animal tissue DNA extraction kit. Samples collected included uninfected snail tissue, infected snail tissue, and stream and deionized water containing both high and low densities of individual free-swimming cercariae. To obtain high-density (more than 100 cercariae) samples, snails were crushed and the cercariae released artificially. The shells of these snails were carefully cracked between the top and bottom of a Petri dish and separated from the snail tissue with dissecting needles. The tissue was then placed in a well slide under a dissecting microscope, whereupon 2-3 drops of deionized water were added, facilitating the release of the cercariae. A micropipette was used to transfer the cercariae into microcentrifuge tubes in preparation for DNA extraction. Cercariae that were allowed to emerge naturally from submerged snails were used for the low-density samples. In this method of harvesting, two to three snails were placed in the bottom of a 50 mL plastic conical tube containing either deionized water or stream water from Strawberry Creek on the UC Berkeley campus. Each tube was placed beneath a 60-watt light bulb to attract the cercariae to the surface. The optimal time to allow the cercariae to emerge and swim to the surface of the water was determined to be 12-15 hours. After this amount of time, an average of 20 free-swimming cercariae could be collected per 80 μL of surface water. After the cercariae died, they sank to the bottom of the tube. Once water samples containing a specified amount of cercariae were obtained, their DNA was extracted. The Qiagen DNA extraction kit allowed for the purification of cellular DNA with silica-gel membrane technology instead of organic extraction or direct ethanol precipitation. The procedure for DNA extraction involved lysing the cells with proteinase K and using a variety of buffers to facilitate the binding of DNA to the silicagel membrane. Following cell lysis and incubation at high temperatures in a hot water bath, contaminants were flushed from the membrane through a series of centrifugation steps, and the DNA was eluted in buffer in order to be made available for use in the PCR assays. The PCR assay was based on a standard protocol with the variants being the gene sequence selected for amplification and the oligonucleotide primers that correspond to its 5’ and 3’ ends (Harris 1998). In this case, the target gene sequences were selected from SRj2, a 3.9 kilobase (kb) non-long terminal repeat retrotransposon described by Dr. Paul Brindley and others (Laha et al 2002). Hybridization analysis indicated that approximately 10,000 copies of the retrotransposon can be found among the S. japonicum chromosomes, which is equivalent to approximately 14% of the entire genome. The frequent occurrence of this retrotransposon made a sequence within it an ideal candidate for PCR amplification, especially from samples containing very few cercariae. One long (1328 basepair (bp)) and one short (916 bp) sequence were chosen as target sequences from within the endonuclease domain of the retrotransposon, a region more likely to be species specific than the highly conserved reverse transcriptase domain (see Table 1). The same 20 nucleotide (nt) upper primer was used for both sequences, so the shorter target sequence is essentially equivalent to the first two-thirds of the longer target sequence. The primers were designed using Oligo Explorer® primer design software and were synthesized by the Qiagen® corporation. Before selecting the primers, the SjR2 sequence was compared to the SR2 sequence from S. mansoni (which belongs to the same clade of non-long terminal repeat retrotransposons) using Clustal X genome analysis software to ensure that an area of significant homology was not selected as the target sequence. SjR2 Primer Primer Sequence Primer length (nt) Target sequence length (kb) Upper Primer AGCCCAGTTTCTTTTTCAGG 20 Lower Primer 1 ATGTCAACCGATGTCTTTCC 20 916 Lower Primer 2 TGCCGAGGATCTATCAGTTC 2